ID: 1175506673_1175506682

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1175506673 1175506682
Species Human (GRCh38) Human (GRCh38)
Location 20:59490902-59490924 20:59490939-59490961
Sequence CCGCAGGAGCTCGGCTTTTTCCC ACTGAGGTGGAGAATGTGGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!