ID: 1175524282_1175524287

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1175524282 1175524287
Species Human (GRCh38) Human (GRCh38)
Location 20:59622818-59622840 20:59622854-59622876
Sequence CCCACCAGGAGATGCACATCCTG AACTGCTATCCAGAGTGTCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!