ID: 1175529281_1175529286

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1175529281 1175529286
Species Human (GRCh38) Human (GRCh38)
Location 20:59663016-59663038 20:59663042-59663064
Sequence CCTTGAAAGTTTCTGGGGCAGGA CCCTGGGCCTCTCTAGCGTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 16, 4: 252} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!