ID: 1175539703_1175539710

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1175539703 1175539710
Species Human (GRCh38) Human (GRCh38)
Location 20:59740861-59740883 20:59740911-59740933
Sequence CCTCATATGGCTCTTCTCAGGCT AGGCCGTCCTGGGCCTCCTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 32, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!