ID: 1175587011_1175587015

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1175587011 1175587015
Species Human (GRCh38) Human (GRCh38)
Location 20:60149103-60149125 20:60149134-60149156
Sequence CCTGATAGGATCTCAGGAGCTGG GCCCAAGTATGTGCACTAAATGG
Strand - +
Off-target summary {0: 1, 1: 43, 2: 189, 3: 316, 4: 418} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!