ID: 1175606636_1175606645

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1175606636 1175606645
Species Human (GRCh38) Human (GRCh38)
Location 20:60316808-60316830 20:60316861-60316883
Sequence CCTTATCCTTGTGTTCCCCAAGT TGTCTCTGTGTTCCGCCTCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!