ID: 1175625145_1175625152

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1175625145 1175625152
Species Human (GRCh38) Human (GRCh38)
Location 20:60483659-60483681 20:60483680-60483702
Sequence CCCCAAGTGGGGTCTGCTGGGTG TGCTGGTCAAATGATGGGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!