ID: 1175664087_1175664091

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1175664087 1175664091
Species Human (GRCh38) Human (GRCh38)
Location 20:60843607-60843629 20:60843630-60843652
Sequence CCAAGGGAAAACTGGCAGGGGAC AGGCAGGAGAGGCCCATGTCAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 2, 3: 24, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!