ID: 1175685293_1175685302

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1175685293 1175685302
Species Human (GRCh38) Human (GRCh38)
Location 20:61024068-61024090 20:61024095-61024117
Sequence CCCACGCGGCCACTCGCAGGGAG CCACCCACGTGGCCACTCGCAGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 0, 3: 15, 4: 45} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!