ID: 1175709517_1175709527

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1175709517 1175709527
Species Human (GRCh38) Human (GRCh38)
Location 20:61208050-61208072 20:61208078-61208100
Sequence CCCCGGACCTAACATCCAGCCTG AATACTGGGTGTAGAAGGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 26, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!