ID: 1175724813_1175724824

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1175724813 1175724824
Species Human (GRCh38) Human (GRCh38)
Location 20:61310587-61310609 20:61310616-61310638
Sequence CCCCCTTCCTGCTGTCCAGCCTG AACAGGCCATGCACTGCCATGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 25, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!