ID: 1175768231_1175768238

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1175768231 1175768238
Species Human (GRCh38) Human (GRCh38)
Location 20:61606007-61606029 20:61606042-61606064
Sequence CCTCTGGGCAATGCTGGGCAATG CTCTGAGGACACATGGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 215} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!