ID: 1175812491_1175812498

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1175812491 1175812498
Species Human (GRCh38) Human (GRCh38)
Location 20:61866022-61866044 20:61866058-61866080
Sequence CCTGTCACCACCAGCATCCTGGC AGGGACCGAAGTTTCCTACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 320} {0: 1, 1: 0, 2: 0, 3: 5, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!