ID: 1175813936_1175813944

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1175813936 1175813944
Species Human (GRCh38) Human (GRCh38)
Location 20:61873894-61873916 20:61873942-61873964
Sequence CCGAGAGGTGAGGCGGGGTGGGG GGTCCCCGCAGGACACCCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 429} {0: 1, 1: 0, 2: 1, 3: 12, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!