ID: 1175847000_1175847008

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1175847000 1175847008
Species Human (GRCh38) Human (GRCh38)
Location 20:62064788-62064810 20:62064804-62064826
Sequence CCCCGGCGCCGGCGCCGCAGCCG GCAGCCGCCGCGCCGGGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 228, 4: 932} {0: 1, 1: 0, 2: 4, 3: 112, 4: 1212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!