ID: 1175847306_1175847321

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1175847306 1175847321
Species Human (GRCh38) Human (GRCh38)
Location 20:62065555-62065577 20:62065590-62065612
Sequence CCGCTCCGGGCGCGCCCTCGGCG CCTGCGCCCGCGGCTCCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 161} {0: 1, 1: 0, 2: 1, 3: 35, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!