ID: 1175847594_1175847608

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1175847594 1175847608
Species Human (GRCh38) Human (GRCh38)
Location 20:62066480-62066502 20:62066518-62066540
Sequence CCTCCAAGCCGCCGCGGGGAAGC CTCAGCCGGTCCCGGGCGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!