ID: 1175889601_1175889611

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1175889601 1175889611
Species Human (GRCh38) Human (GRCh38)
Location 20:62310385-62310407 20:62310434-62310456
Sequence CCTGCTGAGGCCTGGGATGCCAG CCCCGCTGCCTGGGAAGAACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 32, 4: 370} {0: 1, 1: 0, 2: 1, 3: 20, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!