ID: 1175893618_1175893633

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1175893618 1175893633
Species Human (GRCh38) Human (GRCh38)
Location 20:62326534-62326556 20:62326568-62326590
Sequence CCTCCCCAGCCCCCACCCCGCTT CTGTTTTCCACCACGGAGAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 26, 3: 236, 4: 1866} {0: 1, 1: 0, 2: 1, 3: 5, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!