ID: 1175893791_1175893803

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1175893791 1175893803
Species Human (GRCh38) Human (GRCh38)
Location 20:62327191-62327213 20:62327227-62327249
Sequence CCATCCTCAAAGTGCCTCCCCCA GCTTACCCGGTCCCCCAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 442} {0: 1, 1: 0, 2: 0, 3: 40, 4: 947}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!