ID: 1175894301_1175894311

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1175894301 1175894311
Species Human (GRCh38) Human (GRCh38)
Location 20:62329294-62329316 20:62329312-62329334
Sequence CCTGCAGCGGGGAGGCCCCCAGA CCAGAGGCTGGCTGGGACCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 259} {0: 1, 1: 1, 2: 4, 3: 55, 4: 548}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!