ID: 1175903253_1175903263

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1175903253 1175903263
Species Human (GRCh38) Human (GRCh38)
Location 20:62368143-62368165 20:62368191-62368213
Sequence CCTGGCAAACAGCACAGGACCTA CCTTTGGGTGGCTGCGGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 216} {0: 1, 1: 0, 2: 1, 3: 40, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!