ID: 1175914002_1175914007

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1175914002 1175914007
Species Human (GRCh38) Human (GRCh38)
Location 20:62417270-62417292 20:62417303-62417325
Sequence CCCGGAGCTGGTGGTTCTTGGAG CGATCCTCTGGGCGTCCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 275} {0: 1, 1: 0, 2: 2, 3: 11, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!