ID: 1175935828_1175935837

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1175935828 1175935837
Species Human (GRCh38) Human (GRCh38)
Location 20:62513620-62513642 20:62513641-62513663
Sequence CCGGGAAGCTCCCTGCCCTGCTT TTGGCATTGTGTGGTGGGCACGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!