ID: 1175936248_1175936258

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1175936248 1175936258
Species Human (GRCh38) Human (GRCh38)
Location 20:62515462-62515484 20:62515486-62515508
Sequence CCACCTGGAAACCCGCAGGTGGG CTGGTTCACCCCAGGGGTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 131} {0: 1, 1: 0, 2: 3, 3: 7, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!