ID: 1175963531_1175963540

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1175963531 1175963540
Species Human (GRCh38) Human (GRCh38)
Location 20:62648752-62648774 20:62648794-62648816
Sequence CCAGGGCCTTGGCTGATGACTGG GCCTCTTGTCCCCACCGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 263} {0: 1, 1: 0, 2: 0, 3: 16, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!