ID: 1175963838_1175963855

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1175963838 1175963855
Species Human (GRCh38) Human (GRCh38)
Location 20:62650300-62650322 20:62650337-62650359
Sequence CCCTTCTTCCCCAAGCCCAGCTG CCTTGGTGGGGCCAGTCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 58, 4: 465} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!