ID: 1175983657_1175983662

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1175983657 1175983662
Species Human (GRCh38) Human (GRCh38)
Location 20:62753742-62753764 20:62753762-62753784
Sequence CCAGGGAGGGGTGCCGGTTTCTC CTCCATTGGAAGCCGGGCCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!