ID: 1175995695_1175995697

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1175995695 1175995697
Species Human (GRCh38) Human (GRCh38)
Location 20:62811413-62811435 20:62811427-62811449
Sequence CCGGGGCTTCAGGGATGGTGCCT ATGGTGCCTGAGCTCTCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 354} {0: 1, 1: 0, 2: 3, 3: 19, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!