ID: 1175996171_1175996184

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1175996171 1175996184
Species Human (GRCh38) Human (GRCh38)
Location 20:62813215-62813237 20:62813246-62813268
Sequence CCAGCCGAGAGCCCATCGGAGAC CCCGCCCAGCAGGACCTGCAGGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 1, 3: 4, 4: 60} {0: 1, 1: 4, 2: 1, 3: 19, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!