ID: 1176008194_1176008203

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1176008194 1176008203
Species Human (GRCh38) Human (GRCh38)
Location 20:62877469-62877491 20:62877489-62877511
Sequence CCTCCTCCCGACCTTCCTGCCCA CCATCGTCTCCAGAGCTGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!