ID: 1176008907_1176008920

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1176008907 1176008920
Species Human (GRCh38) Human (GRCh38)
Location 20:62881257-62881279 20:62881288-62881310
Sequence CCAGGCGCCTCGCCTGCCGGGGG GTTTGACGCCTGGCTGGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 247} {0: 1, 1: 0, 2: 1, 3: 2, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!