ID: 1176015504_1176015521

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1176015504 1176015521
Species Human (GRCh38) Human (GRCh38)
Location 20:62929259-62929281 20:62929297-62929319
Sequence CCAAGGACAGGGCCCCCGCCGAG CCAGGTCTCGGCCTTTGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 173} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!