ID: 1176015514_1176015530

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1176015514 1176015530
Species Human (GRCh38) Human (GRCh38)
Location 20:62929283-62929305 20:62929314-62929336
Sequence CCACCGGGCAGCGTCCAGGTCTC GGAGGGGAGCAGCGGGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!