ID: 1176019831_1176019842

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1176019831 1176019842
Species Human (GRCh38) Human (GRCh38)
Location 20:62956978-62957000 20:62957002-62957024
Sequence CCCCATCTCCTGGCTGGTGGGGG CGCCCCACTGGGGCCTCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 344} {0: 1, 1: 0, 2: 2, 3: 20, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!