ID: 1176029502_1176029514

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1176029502 1176029514
Species Human (GRCh38) Human (GRCh38)
Location 20:63005210-63005232 20:63005251-63005273
Sequence CCTCCACGCAGCCCCCCGAGGCA CTCCATCCAACTCCACCCCGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 23, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!