ID: 1176042406_1176042425

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1176042406 1176042425
Species Human (GRCh38) Human (GRCh38)
Location 20:63072444-63072466 20:63072496-63072518
Sequence CCGAGACCCCGCAAGGGCAGTGC CCCGAGGCCGGGACGGGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 127} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!