ID: 1176044506_1176044514

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1176044506 1176044514
Species Human (GRCh38) Human (GRCh38)
Location 20:63085399-63085421 20:63085418-63085440
Sequence CCCGGAGCCACTTGGAGCTCAGG CAGGAACAGCAGAGGGAGGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!