ID: 1176044846_1176044853

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1176044846 1176044853
Species Human (GRCh38) Human (GRCh38)
Location 20:63087219-63087241 20:63087272-63087294
Sequence CCTGTCTGTGGCATCCAGAGCTC GAGTGAGGCACTGATTCTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 130} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!