ID: 1176052775_1176052786

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1176052775 1176052786
Species Human (GRCh38) Human (GRCh38)
Location 20:63129286-63129308 20:63129337-63129359
Sequence CCGTCCACCTGCTCCTCAGGAGG TTCTCTGTACATTTTAGAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 402} {0: 1, 1: 0, 2: 4, 3: 75, 4: 605}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!