ID: 1176067894_1176067898

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1176067894 1176067898
Species Human (GRCh38) Human (GRCh38)
Location 20:63208779-63208801 20:63208805-63208827
Sequence CCAGAGCTGCCCAGGCACAGCAG GCCCTGTGCCAAGCATCTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 21, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!