ID: 1176083393_1176083397

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1176083393 1176083397
Species Human (GRCh38) Human (GRCh38)
Location 20:63285067-63285089 20:63285084-63285106
Sequence CCTCCTCGGGGCCTGGGCTCCTC CTCCTCTTGGACCCCCCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 39, 4: 403} {0: 1, 1: 0, 2: 3, 3: 19, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!