ID: 1176085280_1176085297

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1176085280 1176085297
Species Human (GRCh38) Human (GRCh38)
Location 20:63293026-63293048 20:63293076-63293098
Sequence CCTTCGTGCTGGGATCTTTGTGG CGGCAGACAGGAAGGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 109} {0: 1, 1: 0, 2: 5, 3: 61, 4: 867}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!