ID: 1176088623_1176088630

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1176088623 1176088630
Species Human (GRCh38) Human (GRCh38)
Location 20:63309248-63309270 20:63309266-63309288
Sequence CCAGTCTCCATGGAGACCCCCAC CCCACCGCAGGTGGCCCCGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 269} {0: 1, 1: 0, 2: 0, 3: 8, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!