ID: 1176097544_1176097553

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1176097544 1176097553
Species Human (GRCh38) Human (GRCh38)
Location 20:63351224-63351246 20:63351267-63351289
Sequence CCACATCCACACCCACGTCCACG CAGAGGCATTCTCACGTCACAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 11, 3: 108, 4: 565} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!