ID: 1176103906_1176103910

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1176103906 1176103910
Species Human (GRCh38) Human (GRCh38)
Location 20:63376822-63376844 20:63376855-63376877
Sequence CCAGGGTCACGGTCTACAGGCTG GCTCTGAGGACACCTCAACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!