ID: 1176117267_1176117279

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1176117267 1176117279
Species Human (GRCh38) Human (GRCh38)
Location 20:63438549-63438571 20:63438585-63438607
Sequence CCAGCGGCCTCCACTCCTCAACA ACAAGGGCTGTGCTGGTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 300} {0: 1, 1: 0, 2: 2, 3: 37, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!