ID: 1176125755_1176125762

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1176125755 1176125762
Species Human (GRCh38) Human (GRCh38)
Location 20:63473736-63473758 20:63473760-63473782
Sequence CCGGCAGCCATGTGTCCTGGGAG GGTCCCTCTGGAGCTGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 23, 4: 314} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!