ID: 1176131645_1176131676

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1176131645 1176131676
Species Human (GRCh38) Human (GRCh38)
Location 20:63498966-63498988 20:63499013-63499035
Sequence CCGGCCACCCTCTGCCCCCCAGG GAAGACGGGGGCGGGGGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 142, 4: 1280} {0: 1, 1: 3, 2: 39, 3: 381, 4: 2404}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!