ID: 1176139581_1176139590

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1176139581 1176139590
Species Human (GRCh38) Human (GRCh38)
Location 20:63539124-63539146 20:63539142-63539164
Sequence CCAGCCCCTCCCCTAGGTTCTCC TCTCCCATGCAGATGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 58, 4: 681} {0: 1, 1: 0, 2: 2, 3: 25, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!